Module 3: Gene Editing by Recombineering With or Without CRISPR-Cas9

Week 1: Recombineering of

Objectives

To learn principles and practice techniques of bacterial recombineering.

Introduction

Bacterial recombineering can be attained by transforming an E. coli strain expressing the λRed phage-encoded proteins Gam, Exo, and Beta, with linear DNA containing the desired change flanked by short base homologies to the target region of the bacterial genome.1,2 The three λRed proteins induce a hyper-recombinogenic state in bacteria. Although the linear DNA for recombineering can be double- or single-stranded (ds or ss), the ssDNA provides high recombination efficiency in making point mutations and requires only λBeta, a ssDNA annealing protein (SSAP).20 The protein uses a short single-stranded DNA region, such as the single-stranded oligodeoxynucleotide (ssODN), to find and initiate homologous recombination with the target sequence in the bacterial genome. The homology is recognized by λBeta monomers, which weakly hold ssDNA strands together to protect the entering ssDNA from being degraded by host nucleases and aid in forming a DNA protein complex to allow the annealed oligo to function as a primer for DNA replication (Figure 3-2, right). Meanwhile, λBeta binds to a short ssDNA region of the replicating DNA template to initiate ssDNA annealing for homologous recombination with the bacterial chromosome.

In most prokaryotic genomes, genes are preferentially located on the leading strand of DNA replication rather than a random distribution.17 Functional genes, such as ribosomes, have higher preferences for being on the leading strands, whereas genes of other types, such as transcription factors, prefer to be on the lagging strands. Will there be any difference in recombineering efficiencies between the two complementary donor single-stranded oligodeoxynucleotides (ssODNs) corresponding to the leading and lagging DNA sequences (sense vs. antisense ssODN) as the donor DNA? Does the antisense ssODN have a higher editing efficiency since it corresponds to the sequence of the Okazaki fragment of the lagging strand?

Besides gene editing, pre-existing spontaneous mutations generated during cell divisions in a non-selection medium can result in new bacterial strains identified after plating on a selection medium. Luria and Delbrück’s experiment showed that phage resistance due to spontaneous mutation pre-existed in populations of phage-sensitive wild-type E. coli (“spontaneous” model for mutation) rather than after exposure to phage (“acquired” model of mutation).21,22 Similarly, with wild-type E. coli and the ΔmutS mutant, missing a protein for the MMR pathway, Hutchison et al. showed that when the streptomycin-sensitive wild-type was first grown on a medium without streptomycin, spontaneous mutations occurred and reproduced after plating these cells on a streptomycin-containing medium.23 This is because the sensitive cells were killed off, and the individual mutated cells that developed streptomycin resistance survived. Over time, each single cell divided to form a population of bacteria (a colony) that was streptomycin-resistant. In addition, without a proper function of its repair pathway, the ΔmutS mutant produced more resistant colonies than that of the wild-type.

Single-nucleotide gene editing cannot be distinguished from spontaneous point mutations. Plus, the frequency of an adjacent dinucleotide spontaneous mutation theoretically is lower than that of single-nucleotide one. Thus, the ssODNs with a dinucleotide alteration at # 128 and #129 of the rpsL (AA→CC for the sense ssODN and TT→GG for the antisense ssODN) are used to differentiate the spontaneous point mutation (A→C substitution at nucleotide #128) from the two-nucleotide edited cells (Figure 3-4). This AA→CC substitution at nucleotides #128 and #129 makes the same K42T (lysine to threonine conversion at the amino acid #42) as that of the A→C single-nucleotide alteration.24

DNA sequence with four highlighted rows displaying color-coded nucleotides and corresponding amino acids. Red, yellow, and blue colors highlight different sections.
Figure 3-4 Nucleotide and amino acid sequences of the E. coli rpsL gene. Underline: the target codon aaa (lysine) converted to acc (threonine); yellow highlight: the region of ssODNs; red/dashed underline: the forward primer (5′-atggcaacagttaaccagct-3′); blue/boxed: the reverse complement sequence of the reverse primer (5′-ccttaggacgcttcacgc-3′).

The ssODNs and antisense ssODNs are inserted into the recombineering E. coli strain HME63 separately by electroporation, an important gene transfer method in microbes, which allows genetic materials to enter cells and yield a high transformation frequency and gene expression.25,26,27,28 To validate proper gene editing, streptomycin-resistant colonies are subjected to colony PCR. Sequences of the ssODN and antisense ssODN and two PCR primers are shown in Table 3-1. The expected ~370bp PCR products can be validated by agarose gel electrophoresis, purified, and then sent for DNA sequencing, followed by sequence analysis. Since both pre-existing spontaneous point mutation and edited bacteria survive on the streptomycin medium, the use of ssODNs with a dinucleotide substitution better represents recombineering because it can discriminate the potential spontaneous point mutation (A→C, single nucleotide change) from the recombineering edited cells (AA→CC, a two-nucleotide alteration).

Table 3-1 Oligonucleotides used in this module.
Name Sequence (5′ → 3′) Use
rpsL- K42T (ssODN) atgtactcgtgtatatactaccactcctaccaaaccgaactccgcgctgcgtaaagtat Allelic exchange
rpsL- K42T (antisense) atactttacgcagcgcggagttcggtttggtaggagtggtagtatatacacgagtacat Allelic exchange
rpsL-F (forward primer) atggcaacagttaaccagct PCR
rpsL-R (reverse primer) ccttaggacgcttcacgc PCR
Protospacer Adjacent Motif (PAM) sequences are in bold.
The PAM sequence for the Cas9 from Streptococcus pyogenes is NGG, which is essential for the Cas9 nuclease to bind and cleave target DNA.
The two-nucleotide change of the ssODN (aa → cc) and antisense ssODN (tt → gg) are boxed.

For this week’s lab, we will conduct experiments for the comparison of the recombineering efficiencies between the two complementary sense vs. antisense ssODN as donor DNA, to see if the antisense ssODN has a higher editing efficiency than the sense one assuming the rpsL is located in the leading strand.

Procedure

A. Bacterial Recombineering

Before the lab, all equipment must be set up at the proper temperature. Procedures for recombineering competent cell preparation and electroporation are modified from Nature Protocols by Sharan et al.3

Instructor Preparation

  1. Streak recombineering E. coli HME63 strain from a glycerol stock onto an LB plate and incubate at 30–32°C overnight.
  2. Grow a single isolated colony from the plate in a 5 ml LB medium at 30–32°C, shaking at 225 rpm overnight.
  3. Transfer 0.8 ml overnight culture to 40 ml of LB in a 250 ml flask (OD600 = ~0.03) grown at 30–32°C with shaking at 225 rpm until the OD600 is 0.4–0.6 (~4 hrs). One flask for every two student groups.
  1. Place the flask in a 42°C shaking water bath at 200–225 rpm for 15 min, followed by immediately swirling it in an ice-cold water slurry and chilling it for 5–10 min. The process induces the λRed gene expressions for homologous recombination.
  2. Transfer the culture into a prechilled Oakridge tube with a sticker labeled with your group number, and centrifuge at 4,000 g (6,700 rpm) in the Sorvall Legend RT Refrigerated Benchtop Centrifuge with a Sorvall SA-600 rotor at 4°C for 7 min.
  3. Obtain three 1.5 ml microcentrifuge tubes and one sterile 1 mm Gene Pulser cuvette with cap (See Equipment and Materials on Preparing Electroporation Cuvettes), and place them on ice.
  4. After centrifuging, immediately and carefully pour the supernatant into the 250 ml culture flask without losing the pellet!
  5. Gently resuspend the pellet in 2 ml ice-cold sterile H2O, add another ~35 ml, invert the tube several times, and centrifuge at 6,700 rpm at 4°C for 7 min.
  6. Repeat step 4.
  7. Gently resuspend the pellet with 2 ml ice-cold sterile H2O.
  8. Split the solution by pipetting ~1 ml resuspended cells into each of two prechilled 1.5 ml microcentrifuge tubes labeled with your group number.
  9. Centrifuge at 13,000 rpm and 4°C for 30 sec.
  10. Carefully remove the supernatant with a sterile 200 µl pipette tip.
  11. Use a new 1000 µl (1 ml) sterile pipette tip, and resuspend each pellet with 1 ml ice-cold sterile H2O (be careful to do this without spilling the solution).
  12. Repeat steps 9 and 10.
  13. Use a 200 µl pipette cut at 0.3 cm from the tip to gently resuspend each pellet with 75 µl of sterile, ice-cold H2O. Please keep the tube on ice.

For electrotransformation, each group set up only one of the three samples shown in Table 3-2 and then perform electroporation.

  1. Add H2O, ssODN, or antisense-ssODN into a prechilled 1.5 ml microcentrifuge tube labeled H2O (C), antisense-ssODN (A), or ssODN (S) (See Table 3-2 below) and keep on ice for electroporation.
    Table 3-2 Electroporation Setup
    Group number 1, 2 3, 4 5, 6
    Treatments Control (C) Antisense-ssODN (A) ssODN
    Antisense-ssODN 4 µl (= 100 pmol)
    ssODN 4 µl (= 100 pmol)
    H2O (control) 10 µl 6 µl 6 µl

    Note: The electroporator can only hold one sample at a time. Each group should wait until the previous group has completed steps 15 and 16 before adding bacteria from step 13 to the 1.5 microcentrifuge tube for electroporation.

  2. Pipette 55 µl of bacterial suspension from step 13 into the 1.5 ml microcentrifuge tubes from step 14. Mix by gently pipetting up and down 3X without making bubbles before transferring the entire solution into the prechilled sterile electroporation cuvette. (Do not label the cuvette or its cap.)
  3. Immediately electroporate cells using a MicroPulser Electroporator (Bio-Rad) at 1.8 kV and 5 msec, and then quickly add ~1 ml of LB medium into the cuvette. Note: The period between applying the pulse and adding the growth medium is crucial for the recovery of E. coli transformants.25 Delaying it by 1 min causes a 3X drop in transformation efficiency and a 20X reduction by 10 mins.
  1. Continue electroporating each group sample until all have been completed.
  2. Use a sterile glass pipette with a cotton plug to transfer the electroporated mixture in each cuvette into a 15 ml Falcon tube/culture tube labeled with C, A, and S and your group number.
  3. Place tubes at 30–32°C with shaking at 225 rpm for ≥ 3 hrs.
  4. Plate bacteria on agar plates following the instructions in Procedure B below.

Note: The minimal 3 hours of incubation allows bacteria to recover, perform homologous recombination, replicate, and express the antibiotic gene.

B. Making Dilutions and Plating

Do not vortex but gently pipet when mixing!

  1. From each group’s bacterial culture (step 19), make 1 ml of each of 102, 104, and 106 serial dilutions in LB medium in each of the three 1.5 ml sterile microcentrifuge tubes following the steps below.
    1. Add 10 µl from the electrotransformation tube C, A, or S to 990 µl LB, and mix (102 dilution).
    2. Add 10 µl from step a to 990 µl of LB and mix (104 dilution).
    3. Add 10 µl from step b to 990 µl of LB and mix (106 dilution).
  2. Use a spreader to plate 10, 50, and 100 µl of 106 dilution on each of the three LB plates.
  3. Plate 10, 50, and 100 µl of undiluted bacterial culture (step 19 above) on each of three Streptomycin (50 mg/L) LB plates. (Use the same spreader for steps 2 and 3.)
  4. Let all plates sit upright for as long as possible.
  5. Turn them upside down and incubate all plates at 30–32°C overnight.
  6. The next day, count any colonies present, record the data in Table 3-3, and take pictures of the plates.
  7. Seal the plates with parafilm strips, and store all plates upside-down in the refrigerator for next week.
Table 3-3 Number of colonies on each plate
Treatment Control (H2O) Antisense-ssODN ssODN
Group number 1 2 3 4 5 6
LB (10 µl of E^6 dilution)
LB (50 µl of E^6 dilution)
LB (100 µl of E^6 dilution)
Strep-50 (10 µl)
Strep-50 (50 µl)
Strep-50 (100 µl)

Data Analysis and Discussion

  1. Based on your results from the LB dilution plates without antibiotics, what is the bacterial concentration of the (a) control, (b) antisense-ssODN, or (c) ssODN transformation tube?
  2. What is the frequency of strepR colonies in the (a) control, (b) ssODN, or (c) antisense-ssODN transformation tube? (d) Does the control tube produce any colonies on the streptomycin plates? Why or why not?
  3. Did the experiment work? Explain.

License

Icon for the Creative Commons Attribution-ShareAlike 4.0 International License

Molecular Techniques Copyright © 2026 by Ming-Mei Chang is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License, except where otherwise noted.

Share This Book